Design CAPS/dCAPS and KASP primer for SNP site.

Choose Genome:   Chinese Spring genome v1.0 Chinese Spring genome v2.1 Fielder genome Zang1817 genome ArinaLrFor genome Jagger genome Julius MAGIC3 genome LongReach Lancer genome CDC Landmark genome Mace genome Norin61 genome CDC Stanley genome Robigus genome Paragon genome Claire genome Cadenza genome Weebill genome SY Mattis genome Renan genome Spelta PI190962 genome Wild emmer genome v1.0 Wild emmer genome v2 Durum wheat genome v1.0 Triticum urartu genome v2.0 (cv. G1812) Aegilops tauschii genome (cv. AL8/78) Aegilops tauschii genome Aet5.0 (cv. AL8/78) Aegilops tauschii genome (cv. AY17) Aegilops tauschii genome (cv. AY61) Aegilops tauschii genome (cv. T093) Aegilops tauschii genome (cv. XJ02)
Ploidy:   Contains ABD genome Contains AB genome Contains single genome (A/B/D)
Maximum NEB restriction enzyme price (dollars per 1000 U): 200 400 600 800 1000 more than 1000
Design CAPS/dCAPS primers?   Yes No
Design KASP primers?   Yes No
Maximum Primer Tm:   63  65  67  69  more than 70
Pick primer anyway?   NO  Yes 

Maximum Primer Size (no larger than 36)   25


IWB50236,7A,cctcctcgtttcaaaagaagtaactcatcaaatgattcaaaaatatcgat[A/G]CTTGGCTGGTGTATCGTGCAGACGACAGTTCGTCCGGTATCAACAGCATT IWB58849,7A,ATGACAATCAGAGCATGGAAGAAGACTTCGAGAAAGGAACCGCGCCCAAG[T/C]GGTTTTGCTACAGCGACTTGGCCATGGCCACCGACAACTTTTCCGACGAT

Note:
Due to the high number of users and the large computational load, the server may not meet the calculation demands and could result in errors or lack of results. Please limit the number of submitted loci to within 3.

References:
  We developed a SNP primer design application with a simple HTML form and a python back end.
  The python pipeline was based on Dr. Zhang Junli's github (SNP_Primer_Pipeline).